| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
Between 136 bp to 144 bp of the wild-type fundc2 coding sequence, TGGCCAT, is deleted. The mutated fundc2 codes for a truncated protein containing 48 aa, 45 aa of which is identical to wildtype fundc2. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ205 |
|
|
Between 117 bp to 144 bp of the wild-type fundc2 coding sequence, TACTCTGTGGCCACACAGCTGGCCAT, is deleted. The mutated fundc2 codes for a truncated protein containing 78 aa, 39 aa of which is identical to wildtype fundc2. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ206 |
|
|
140 bp to 146 bp of the wild-type fundc2 coding sequence, CATTG, is mutated into GAGT. The mutated fundc2 codes for a truncated protein containing 50 aa, 46 aa of which are identical to wildtype fundc2. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ207 |
|
|
Between 313 bp to 331 bp of the wild-type KIAA0101 coding sequence, GATCCTCGAACGCGCAG, is deleted. The mutated KIAA0101 codes for a truncated protein containing 114 aa, 104 aa of which are identical to wildtype KIAA0101. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ208 |
|
|
Between 328 bp to 348 bp of the wild-type KIAA0101 coding sequence, AGAGCGGCAGCGCGCAGTC, is deleted. The mutated KIAA0101 codes for a prolonged protein containing 302 aa, 109 aa of which are identical to wildtype KIAA0101. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ209 |
|
|
Between 1302 bp to 1303 bp of the wild-type nhsa coding sequence, GAGTCAT, is inserted. The mutated nhsa codes for a truncated protein containing 436 aa, 434 aa of which are identical to wildtype nhsa. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ210 |
|
|
Between 1303 bp to 1306 bp of the wild-type nhsa coding sequence, GATG, is deleted. The mutated nhsa codes for a truncated protein containing 465 aa, 434 aa of which are identical to wildtype nhsa. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ211 |
|
|
Between 1304 bp to 1305 bp of the wild-type nhsa coding sequence, CTGGTGACTGG, is inserted. The mutated nhsa codes for a truncated protein containing 436 aa, 434 aa of which are identical to wildtype nhsa. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ212 |
|
|
Between 631 bp to 632 bp of the wild-type nlgn2a coding sequence, CTAA, is inserted. The mutated nlgn2a codes for a truncated protein containing 229 aa, 210 aa of which are identical to wildtype nlgn2a. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ213 |
|
|
Between 631 bp to 632 bp of the wild-type nlgn2a coding sequence, CAGCCTATGCAGCCTA, is deleted. The mutated nlgn2a codes for a truncated protein containing 216 aa, 210 aa of which are identical to wildtype nlgn2a. Further MTA needed from the Fish Developmental Biotechnology Lab. |
CZ214 |
