| Select |
Product |
Note |
CZRC
Catalog ID |
|
|
In the wild-type cdc6 coding sequence, GACATGAGCG is deleted in exon 3. The mutated cdc6 codes for a truncated protein containing 141 aa, of which 361 aa are identical to wildtype cdc6. |
CZ405 |
|
|
In the wild-type cdc6 coding sequence, AAGCAGCGCTGCGCTCCTCTG is deleted in exon 2. The mutated cdc6 codes for a truncated protein containing 554 aa, of which 361 aa are identical to wildtype cdc6. |
CZ406 |
|
|
Between 92 bp to 96 bp of the wild-type tgfb1a coding sequence, TGAGG is deleted in exon 1. The mutated tgfb1a codes for a truncated protein containing 34 aa, of which 377 aa are identical to wildtype tgfb1a. |
CZ407 |
|
|
Between 85 bp to 92 bp of the wild-type tgfb1a coding sequence, GAGGTGGT is deleted in exon 1. The mutated tgfb1a codes for a truncated protein containing 33 aa, of which 377 aa are identical to wildtype tgfb1a. |
CZ408 |
|
|
The mutated tsu243 codes for a truncated protein containing EGFP and truncated, and egfp was inserted between GGTGT and ACAGC in the wild-type prpf4 intron 3. |
CZ409 |
|
|
Between 90 bp to 94 bp of the wild-type alkbh4 coding sequence, TGTGG is mutated to A in exon 3. The mutated alkbh4 codes for a truncated protein containing 65 aa, of which 188 aa are identical to wildtype alkbh4. |
CZ410 |
|
|
Between 298 bp to 302 bp of the wild-type atrn coding sequence, CCAGG is deleted in exon 2. The mutated atrn codes for a truncated protein containing 111 aa, of which 1383 aa are identical to wildtype atrn. |
CZ411 |
|
|
Between 89 bp to 91 bp of the wild-type ybx1 coding sequence, GGG is mutated to TCATC in exon 1. The mutated ybx1 codes for a truncated protein containing 43 aa, of which 309 aa are identical to wildtype ybx1. |
CZ412 |
|
|
|
CZ413 |
|
|
The tsu24Tg allele is a transgenic zebrafish line Tg(crybb1:CFP) in which the crybb1 promoter elements drives CFP expression. |
CZ415 |
