Three nucleotides, CAG, located in the splice acceptor site of intron 4, are deleted. Plus the adjacent twenty-nine-nucleotide coding sequence, AGCCACCATAACATCTCTGGAGGACTTTG, is mutated into GAGGCTGAGCAGAGGCTGA. This mutation may lead to mis-splicing of the ndel1a transcript, resulting in the use of an alternative acceptor site (changing the 5’ boundary of the downstream exon 5) or simply the retention of the intron 4. Further MTA needed from the Fish Developmental Biotechnology Lab.
|