| CZRC Catalog ID: |
CZ287 |
| Availability: |
Frozen sperm |
| Genotype: |
net1ioz5/+ |
| Affected Gene: |
net1 |
| Genotyping: |
pdf |
GENOTYPE COMPOSITION
| Genomic Feature |
Zygosity |
Parental Genotype |
Lab of Origin |
Construct |
|---|
| ioz5 |
heterozygous |
|
Qiang Wang Lab |
|
| Background: |
AB |
| Affectedgeneurl: |
https://zfin.org/ZDB-GENE-041121-18 |
| Linetype: |
Mutant |
| Previous Names: |
unspecified |
| Background: |
AB |
| Affectedgeneurl: |
https://zfin.org/ZDB-GENE-041121-18 |
| Linetype: |
Mutant |
| Previous Names: |
unspecified |
Note:
| Between 272 bp to 291 bp of the wild-type net1 coding sequence, GCCAGACCCTCCAGGCCTCA, is deleted; and C, is inserted.
|
